LOC100004160

Ensembl ID:
ENSDARG00000061753
Human Orthologue:
KCNA5
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 5 [Source:HGNC Symbol;Acc:6224]
Mouse Orthologue:
Kcna5
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 5 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33510 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088477 Nonsense 23 545 1 1
Genomic Location (Zv9):
Chromosome 4 (position 59852404)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 73312951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGATAGCTTTGGTGAGTTTTGAAAAGCGCGGAGATGGAGAGAGCTA[C/A]CAGAACCAAAACTCACTGGATCATCCGCGACTGGTCCACAACAAAGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link