si:dkey-218n20.1

Ensembl ID:
ENSDARG00000061752
ZFIN ID:
ZDB-GENE-060503-342
Description:
Protein FAM65B [Source:UniProtKB/Swiss-Prot;Acc:Q1LU99]
Human Orthologue:
FAM65B
Human Description:
family with sequence similarity 65, member B [Source:HGNC Symbol;Acc:13872]
Mouse Orthologue:
Fam65b
Mouse Description:
family with sequence similarity 65, member B Gene [Source:MGI Symbol;Acc:MGI:2444879]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11963 Nonsense Available for shipment Available now
sa12109 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088427 Nonsense 3 870 1 18
ENSDART00000131721 Nonsense 167 1083 6 23
Genomic Location (Zv9):
Chromosome 19 (position 32889630)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32056919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACATTTTTGCTTCCTAGCAAATCAAGACCATAGAGCGATACATGCGA[C/T]GACTGGAGTTTCACATCAGCRAGGTAAAGTTCATGTCTTTTTTTTMNTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088427 Nonsense 828 870 16 18
ENSDART00000131721 Nonsense 1041 1083 22 23
Genomic Location (Zv9):
Chromosome 19 (position 32842139)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32009428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTGATGCTGTCATTTTACTGTGTGACTCTGTGGATGAAGAGCTCCGG[C/T]AGATTGCTATTGAAACCCTCCTCACTTTCGGTAAARTATCCAGTCACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link