LOC569232

Ensembl ID:
ENSDARG00000061747
Human Orthologue:
CXorf36
Human Description:
chromosome X open reading frame 36 [Source:HGNC Symbol;Acc:25866]
Mouse Orthologue:
4930578C19Rik
Mouse Description:
RIKEN cDNA 4930578C19 gene Gene [Source:MGI Symbol;Acc:MGI:1923155]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17295 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088441 Nonsense 266 431 4 5
Genomic Location:
Chromosome 9 (position 34824474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGGACCCTGTTTTCCTCTCCGCTGGAGCGGCGCGCAGATCTCGCCTA[C/A]CAGCTTCTGCACATCACCCAGAGCCTGAGCGCCAACAGCCTGCGGTTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dr6hb9q1