si:ch73-92i20.3

Ensembl ID:
ENSDARG00000061746
ZFIN ID:
ZDB-GENE-070705-271
Human Orthologue:
ARHGEF9
Human Description:
Cdc42 guanine nucleotide exchange factor (GEF) 9 [Source:HGNC Symbol;Acc:14561]
Mouse Orthologue:
Arhgef9
Mouse Description:
CDC42 guanine nucleotide exchange factor (GEF) 9 Gene [Source:MGI Symbol;Acc:MGI:2442233]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2229 Nonsense F2 line generated During 2017
sa5740 Nonsense F2 line generated During 2017
sa9176 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17928 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2229
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Nonsense 149 521 3 10
ENSDART00000134393 Nonsense 152 251 4 5
ENSDART00000143878 Nonsense 180 549 5 11
ENSDART00000088408 Nonsense 149 521 3 10
ENSDART00000134393 Nonsense 152 251 4 5
ENSDART00000143878 Nonsense 180 549 5 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23735602)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21448474
KASP Assay ID:
554-2900.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGTATCTTCGCCAGTGTAAAAAGCGAAGAGACATGTTCAACGACGAT[C/T]AGCTGAAAGTGATCTTCGGAAATATAGAAGACATTTACAGATTCCARCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5740
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Nonsense 149 521 3 10
ENSDART00000134393 Nonsense 152 251 4 5
ENSDART00000143878 Nonsense 180 549 5 11
ENSDART00000088408 Nonsense 149 521 3 10
ENSDART00000134393 Nonsense 152 251 4 5
ENSDART00000143878 Nonsense 180 549 5 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23735602)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21448474
KASP Assay ID:
554-2900.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGTATCTTCGCCAGTGTAAAAAGCGAAGAGACATGTTCAACGACGAT[C/T]AGCTGAAAGTGATCTTCGGAAATATAGAAGACATTTACAGATTCCARCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Essential Splice Site 313 521 5 10
ENSDART00000134393   None 251 None 5
ENSDART00000143878 Essential Splice Site 344 549 7 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23734862)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21447734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACATCGACAAAATYGCYCAAWGGCAGGCCTCTRTGCTGGACTGGGAG[G/A]TGGGTGGCTGAAGSTTTTCATGCAAAGTTYATTAGTTGGRTGGAAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088408 Nonsense 421 521 7 10
ENSDART00000134393   None 251 None 5
ENSDART00000143878 Nonsense 452 549 9 11

The following transcripts of ENSDARG00000061746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23726615)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21439487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYGAGATCCATCTGTTCCTGCCCAAAAAGCTRGAGGAGAAAATCCGTTG[G/A]CTTCGGGCATTTCAAGAGGAAAGAAAGATGGTCCAGGAAGAYGAAAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link