clasrp

Ensembl ID:
ENSDARG00000061742
ZFIN ID:
ZDB-GENE-060503-837
Description:
splicing factor, arginine/serine-rich 16 [Source:RefSeq peptide;Acc:NP_001037794]
Human Orthologue:
CLASRP
Human Description:
CLK4-associating serine/arginine rich protein [Source:HGNC Symbol;Acc:17731]
Mouse Orthologue:
Clasrp
Mouse Description:
CLK4-associating serine/arginine rich protein Gene [Source:MGI Symbol;Acc:MGI:1855695]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43146 Nonsense Mutation detected in F1 DNA During 2016
sa15739 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Nonsense 29 560 2 21
ENSDART00000088425 Nonsense 29 645 1 21
ENSDART00000127825 Nonsense 29 642 2 21
ENSDART00000148032   None 122 None 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 34947235)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36626391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGGATGATGGTGGACTACAAACGGCGTGGGGAAAGGCGAAGAGAGTA[C/G]TATGAAAAAATTGTAAGTCATGCTTTGTTTACTGAAAACAGTCTAACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Nonsense 269 560 10 21
ENSDART00000088425 Nonsense 269 645 9 21
ENSDART00000127825 Nonsense 269 642 10 21
ENSDART00000148032   None 122 None 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 34957671)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36636827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWGGTAATGTGTTGTTGTGTTTCCTTCAGGGCCGGCGGTCTCGCAGACAA[C/T]GAAGAGAGTTCAGAGAGAAGTATATGAAAGGCAGGCAGATCAGCCCACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link