clasrp

Ensembl ID:
ENSDARG00000061742
ZFIN ID:
ZDB-GENE-060503-837
Description:
splicing factor, arginine/serine-rich 16 [Source:RefSeq peptide;Acc:NP_001037794]
Human Orthologue:
CLASRP
Human Description:
CLK4-associating serine/arginine rich protein [Source:HGNC Symbol;Acc:17731]
Mouse Orthologue:
Clasrp
Mouse Description:
CLK4-associating serine/arginine rich protein Gene [Source:MGI Symbol;Acc:MGI:1855695]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15739 Nonsense Available for shipment Available now
sa4763 Nonsense Mutation detected in F1 DNA During 2014
sa7866 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Nonsense 269 560 10 21
ENSDART00000088425 Nonsense 269 645 9 21
ENSDART00000127825 Nonsense 269 642 10 21
ENSDART00000148032 None None 122 None 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 34957671)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWGGTAATGTGTTGTTGTGTTTCCTTCAGGGCCGGCGGTCTCGCAGACAA[C/T]GAAGAGAGTTCAGAGAGAAGTATATGAAAGGCAGGCAGATCAGCCCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Nonsense 555 560 16 21
ENSDART00000088425 None 556 645 16 21
ENSDART00000127825 None 553 642 16 21
ENSDART00000148032 None 33 122 2 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 34967126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGACACCTCAAGAAAAACTCAAACTCCGCATGCAGAAGGCCCTGAA[C/T]AGGCAATGTGAGTTACTGATTCAGGCGTACTGCCYTTTTATAGTCTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088421 Splice Site None 560 17 21
ENSDART00000088425 Splice Site, Nonsense 578 645 17 21
ENSDART00000127825 Splice Site, Nonsense 575 642 17 21
ENSDART00000148032 Splice Site, Nonsense 55 122 3 7

The following transcripts of ENSDARG00000061742 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 34969684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGATAAGAAGGCGGCACAAGCTAAGATCCAGCAACAGGAGCACAAGCGA[C/T]AGGTAAAAGCGTGGGTGTACCTGTGGTATGTGGATGGGGGTAATAGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wkywrvy4