itpr3

Ensembl ID:
ENSDARG00000061741
ZFIN ID:
ZDB-GENE-070605-1
Description:
inositol 1,4,5-triphosphate receptor, type 3 [Source:RefSeq peptide;Acc:NP_001121741]
Human Orthologue:
ITPR3
Human Description:
inositol 1,4,5-triphosphate receptor, type 3 [Source:HGNC Symbol;Acc:6182]
Mouse Orthologue:
Itpr3
Mouse Description:
inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI Symbol;Acc:MGI:96624]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11400 Nonsense Available for shipment Available now
sa17468 Nonsense Available for shipment Available now
sa21271 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21272 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21273 Nonsense Mutation detected in F1 DNA During 2014
sa14415 Nonsense Available for shipment Available now
sa21274 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa13385 Nonsense Available for shipment Available now
sa21275 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15369 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 203 2656 6 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 None None 2293 None 48
ENSDART00000144488 Nonsense 200 332 6 10
Genomic Location:
Chromosome 8 (position 21829893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATCCTGAATCCTGTGAATGCTGGACAGCCTCTCCATGCCAGCAGCTA[T/A]GAGCTTCCCGATCAYTCAGGGTGCAAAGAGGTTTGCGATRARTTAACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 395 2656 13 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 45 2293 2 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21835478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACCCCCTGTCTGTTTATCYTTTTCACYGCCTACAGAAATTCTTATGTT[C/T]GATTTCGYCACCTGTGCACRAACACTTGGATCCAAAGCACCAACATTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Essential Splice Site 524 2656 15 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 174 2293 4 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21838507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACCGAGAGAGACAGAAACTGATGAGAGAGCAGAACATTTTAAAACAG[G/T]TCGGATTTTTTTTTAATAATTTACAAGTTTGCCCGTTGAAACGTCTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Essential Splice Site 821 2656 21 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 471 2293 10 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21845951)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTATTTAAACAATCAAAGGTGTAATAATGTTTGCTGTTTTATGTTATA[G/A]TTATGACTCTCACTTGGACTATTCACGAGACAATAAAAAGAACAAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 868 2656 21 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 518 2293 10 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21846093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCGATGACCTGCCTTTTGCAAACGAGGAGAAAAACAAGCTAACGTA[T/A]GAGGTACTGTGGCATATTATTATGCTTTAGCTCCACTGGTAGTGCTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 964 2656 23 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 613 2293 12 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21847842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGWCGAWCTGGAGACAGTCAAGTCGGCAGTAAAGACAGCATCGAYACA[C/T]AAGACATCACTGTCATGGACACCAAACTCAARATTCTGGAGATTTTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Splice Site, Nonsense 1097 2656 26 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Splice Site, Nonsense 741 2293 15 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21852233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTTCAAGCACTTCAGTCAAAGACAAGAAGTCCTTCATACTTTTAAA[C/T]AGGTAAAAAAGCTGTGCCTAAATAGTTCAGATCAAACATCTGTAGGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 1110 2656 27 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 754 2293 16 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21853548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTTTTCAGGTCCAATTGCTTATTTCAACTCAGGATGTGGACAACTA[T/A]AAACACATAAAACGAGATYTGGATCTGCTGCGCACCATGGTGGAGAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 None 1828 2656 41 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Essential Splice Site 1469 2293 None 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21865265)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGGGAAATGAGCAACAAAGCCAAAGATGACAAAGATCTGGAGACTGG[T/A]AATGCAACCCCACACTTGCTTCCTCTGTAAGGGACACTCCACTTTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088119 Nonsense 2094 2656 48 59
ENSDART00000088133 None None 226 None 8
ENSDART00000129359 None None 232 None 7
ENSDART00000142836 Nonsense 1722 2293 37 48
ENSDART00000144488 None None 332 None 10
Genomic Location:
Chromosome 8 (position 21870356)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTATTTTATTCTGGCTTTTTTATTGCAGCTCAAYCTGAACAAGCAG[C/T]AGGAGGAGGAAAAGGAGGATCCACTAGAGCACTACGACCRTCAAACTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fe30i57z