si:ch211-197g15.3

Ensembl ID:
ENSDARG00000061738
ZFIN ID:
ZDB-GENE-050208-777
Description:
E3 ubiquitin-protein ligase MARCH2 [Source:UniProtKB/Swiss-Prot;Acc:Q1LVZ2]
Human Orthologue:
MARCH2
Human Description:
membrane-associated ring finger (C3HC4) 2 [Source:HGNC Symbol;Acc:28038]
Mouse Orthologue:
March2
Mouse Description:
membrane-associated ring finger (C3HC4) 2 Gene [Source:MGI Symbol;Acc:MGI:1925915]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37488 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088419 Nonsense 160 249 4 5
Genomic Location (Zv9):
Chromosome 22 (position 17742288)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17493223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATGGTGTGCTTTCTGTTTATAACACCCCTGGCAGCCATTTCAGGCTG[G/A]CTGTGTCTACGGGGTGCACAAGACCACCTGCACTTCAACAGTCGTCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link