ANK3 (2 of 2)

Ensembl ID:
ENSDARG00000061736
Description:
ankyrin 3, node of Ranvier (ankyrin G) [Source:HGNC Symbol;Acc:494]
Human Orthologue:
ANK3
Human Description:
ankyrin 3, node of Ranvier (ankyrin G) [Source:HGNC Symbol;Acc:494]
Mouse Orthologue:
Ank3
Mouse Description:
ankyrin 3, epithelial Gene [Source:MGI Symbol;Acc:MGI:88026]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17048 Essential Splice Site Available for shipment Available now
sa13397 Nonsense Available for shipment Available now
sa18498 Essential Splice Site Available for shipment Available now
sa3991 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4707 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23050 Nonsense Mutation detected in F1 DNA During 2014
sa15975 Nonsense Available for shipment Available now
sa23049 Nonsense Mutation detected in F1 DNA During 2014
sa23048 Nonsense Mutation detected in F1 DNA During 2014
sa9548 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Essential Splice Site 549 3980 14 43
Genomic Location:
Chromosome 17 (position 20609488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCAATCTTCTACTGCARAAGAAAGCYGCACCAGATGCTGCAGGCAAG[G/A]TTGGTGAACATATGCATGRTGTAATATTCAGTGCAAAAAACAACATGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Nonsense 603 3980 16 43
Genomic Location:
Chromosome 17 (position 20602962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTCCACATTGCAGCRAAGAAGAATCARTTGGAGATTGGGACGACGT[T/A]GCTGGAATATGGAGCGGAGTGTAACACAGTGACCCGCCAGGGCATCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Essential Splice Site 1134 3980 28 43
ENSDART00000088106 Essential Splice Site 1134 3980 28 43
Genomic Location:
Chromosome 17 (position 20562908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTTCCCGCAGGGAGCGCTTACCAAGAAGATTCGTGTAGGACTACAG[G/A]TACATTTAAACAATAAACAKAAGGGCTCATCAAGATGGCTGTTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Essential Splice Site 1134 3980 28 43
ENSDART00000088106 Essential Splice Site 1134 3980 28 43
Genomic Location:
Chromosome 17 (position 20562908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTTCCCGCAGGGAGCGCTTACCAAGAAGATTCGTGTAGGACTACAG[G/A]TACATTTAAACAATAAACATAAGGGCTCATCAAGATGGCTGTTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Essential Splice Site 1203 3980 29 43
Genomic Location:
Chromosome 17 (position 20561071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAAAGGAGAGCCTGCACCTTGCCTTAGACTGCTGTGTAGCATCACAG[G/A]CATGTGAATAGTGGAAGATTGTNNNNGTTTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Nonsense 1411 3980 35 43
Genomic Location:
Chromosome 17 (position 20557054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTACGTAGGTTTCTTAATTTTGTGTTATTGCAGAATGACAAAGATCGA[C/T]GACATACCTTTGCCTCATTAGCATTGCGAAAGCGCTACAGCTATCTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Nonsense 2505 3980 36 43
Genomic Location:
Chromosome 17 (position 20552639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAAGCATCGTAGACAARATGCAAGGGAGACTCRATCTGGGCCCAGCT[C/A]AACTTGCAGTAGCCCAGAGAGATCAGGGCATAGAAATGGSGGGAGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Nonsense 2919 3980 37 43
Genomic Location:
Chromosome 17 (position 20551380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACACGTGGAGCCTTTTATTCTGTAAAACAGAAGCAGCCACAATCACCT[C/T]AGGGAAGCCCTGAAGATGACACGTTAGAGCAGGTAACATTTATGGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Nonsense 3588 3980 37 43
Genomic Location:
Chromosome 17 (position 20549373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAAGCTCAGTTCTGTAGGGAGTCTGTGGAGAAAGCTTCTCAAAGTCAT[C/T]AGAATAAAGTAGTCTTTGAGAACAGGCAGCCAAAGTCTAGGCTCCCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088106 Nonsense 3723 3980 38 43
Genomic Location:
Chromosome 17 (position 20548956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATTGAGTTCCTAAAGAATGTTAGTGGAGAAGCAATAAAGGTGGCCGAA[C/T]GACTCTCAGATGAGGAGAAACAGACACAGGGAGAGCAGTCGCAATCGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z9lnz3bc