hnrnpm

Ensembl ID:
ENSDARG00000061735
ZFIN ID:
ZDB-GENE-030131-6898
Description:
Novel protein similar to vertebrate myelin expression factor 2 (MYEF2) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
HNRNPM
Human Description:
heterogeneous nuclear ribonucleoprotein M [Source:HGNC Symbol;Acc:5046]
Mouse Orthologue:
Hnrnpm
Mouse Description:
heterogeneous nuclear ribonucleoprotein M Gene [Source:MGI Symbol;Acc:MGI:1926465]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32398 Nonsense Available for shipment Available now
sa9147 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088356 Nonsense 146 664 6 18
ENSDART00000088369   None 233 None 9
ENSDART00000137689   None 540 None 11
Genomic Location (Zv9):
Chromosome 22 (position 17760872)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17511807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCAGCGTGAAGCTAACCGGGGTCATGGTGGTGGCGGAGGTGGCGGT[G/T]GACCCCCAGGCATGGGAGGAGGCATGGGCGGTGGCATGGGAGGAGGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088356 Nonsense 450 664 16 18
ENSDART00000088369   None 233 None 9
ENSDART00000137689 Nonsense 326 540 9 11
Genomic Location (Zv9):
Chromosome 22 (position 17763317)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17514252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCATGTCTGATCTGGACCGCATGGGTTCTAGCTTTGATAGAATGGGGT[C/A]AGGGCTTGACCGTCTCGGCCCCAGCATGGATCGTATGGGWTCAGGCCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link