si:dkey-1h24.3

Ensembl ID:
ENSDARG00000061732
ZFIN ID:
ZDB-GENE-090311-54
Description:
si:dkey-1h24.3 [Source:RefSeq peptide;Acc:NP_001121716]
Human Orthologue:
RAPH1
Human Description:
Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 [Source:HGNC Symbol;Acc:14436]
Mouse Orthologue:
Raph1
Mouse Description:
Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 Gene [Source:MGI Symbol;Acc:MGI:1924

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16153 Essential Splice Site Available for shipment Available now
sa39627 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088290 Essential Splice Site 403 1511 9 15
ENSDART00000125402   None 108 None 3
ENSDART00000136066   None 161 None 2
Genomic Location (Zv9):
Chromosome 1 (position 28679553)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28930382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGAGACTTCTGAGATGGCAGACAGAAACAAGGAGGCACTGCTAGAGG[T/C]AAAGCATGTTATAAAACTAATTATATTGTCAAATCATAGTACTATGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088290 Nonsense 925 1511 15 15
ENSDART00000125402   None 108 None 3
ENSDART00000136066   None 161 None 2
Genomic Location (Zv9):
Chromosome 1 (position 28685804)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28936633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCCACCAATAATGCCCATGCAGTCAGAGCCTCTACCGCCGCCTGCA[C/T]AAATCATGCCCATGCAATCACATCCTCTTCCACCACCTCCACCTTTAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link