MAST3 (2 of 2)

Ensembl ID:
ENSDARG00000061725
Description:
microtubule associated serine/threonine kinase 3 [Source:HGNC Symbol;Acc:19036]
Human Orthologue:
MAST3
Human Description:
microtubule associated serine/threonine kinase 3 [Source:HGNC Symbol;Acc:19036]
Mouse Orthologue:
Mast3
Mouse Description:
microtubule associated serine/threonine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2683541]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19757 Nonsense Available for shipment Available now
sa15294 Nonsense Available for shipment Available now
sa32923 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088346 Nonsense 155 1295 6 28
Genomic Location (Zv9):
Chromosome 2 (position 24419961)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24994828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGACGTGTGGCTCCTTTGATAATGAAATTGTGATGATGAATCACGTTTA[C/A]AAAGAACGGTTTCCAAAGGTAATTAAGTTCAGACATTTACATTTTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088346 Nonsense 264 1295 8 28
Genomic Location (Zv9):
Chromosome 2 (position 24430304)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25005171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAGAAGATTCTCATCATWATTTCCAGGCCAGCAAGACTACTGGAATG[T/A]CTGGTAAAATGAKGATTAACACCGTTTTAAAAAGCATATGTTTTACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088346 Essential Splice Site 993 1295 25 28
Genomic Location (Zv9):
Chromosome 2 (position 24449597)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25024464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTAAAATATGCTTCATTTATTTCATTTATTTATTTATTTTTTTGT[A/T]GAGTGGTAGTAAAGTAACTCTTCAGACGACTCCTCTTGAGAACACGTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link