MAST3 (2 of 2)

Ensembl ID:
ENSDARG00000061725
Description:
microtubule associated serine/threonine kinase 3 [Source:HGNC Symbol;Acc:19036]
Human Orthologue:
MAST3
Human Description:
microtubule associated serine/threonine kinase 3 [Source:HGNC Symbol;Acc:19036]
Mouse Orthologue:
Mast3
Mouse Description:
microtubule associated serine/threonine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2683541]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19757 Nonsense Available for shipment Available now
sa15294 Nonsense Available for shipment Available now
sa5140 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088346 Nonsense 155 1295 6 28
Genomic Location:
Chromosome 2 (position 24419961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGACGTGTGGCTCCTTTGATAATGAAATTGTGATGATGAATCACGTTTA[C/A]AAAGAACGGTTTCCAAAGGTAATTAAGTTCAGACATTTACATTTTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088346 Nonsense 264 1295 8 28
Genomic Location:
Chromosome 2 (position 24430304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAGAAGATTCTCATCATWATTTCCAGGCCAGCAAGACTACTGGAATG[T/A]CTGGTAAAATGAKGATTAACACCGTTTTAAAAAGCATATGTTTTACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088346 Nonsense 963 1295 24 28
Genomic Location:
Chromosome 2 (position 24449406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCCCATTTCTCCAGAGTGTTGAAGACTGCAGCCCTGCTCACGAGGCC[G/T]GACTGAGGGCTGGTGACCTCATCACTCATGTGAACGGAGAGTGTATTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w4xj6owl