setdb1b

Ensembl ID:
ENSDARG00000061724
ZFIN ID:
ZDB-GENE-061013-224
Description:
Histone-lysine N-methyltransferase SETDB1-B [Source:UniProtKB/Swiss-Prot;Acc:Q08BR4]
Human Orthologue:
SETDB1
Human Description:
SET domain, bifurcated 1 [Source:HGNC Symbol;Acc:10761]
Mouse Orthologue:
Setdb1
Mouse Description:
SET domain, bifurcated 1 Gene [Source:MGI Symbol;Acc:MGI:1934229]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17791 Essential Splice Site Available for shipment Available now
sa36108 Essential Splice Site Available for shipment Available now
sa42708 Nonsense Mutation detected in F1 DNA During 2017
sa32086 Essential Splice Site, Splice Site Available for shipment Available now
sa42707 Nonsense Mutation detected in F1 DNA During 2017
sa25012 Nonsense Mutation detected in F1 DNA During 2017
sa36107 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Essential Splice Site 145 1214 4 22
ENSDART00000131249   None 279 None 6
ENSDART00000137317   None 265 None 5
ENSDART00000144691   None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24098029)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22104495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGTGGTTCCTCCCAAGAAGRGTTTAACTCAAGCCAAGGACCCAGCRG[T/A]AAGGGAATGCCTTTGTATCAACTGACAAACCGCACGTTTACTGTAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Essential Splice Site 311 1214 7 22
ENSDART00000131249   None 279 None 6
ENSDART00000137317   None 265 None 5
ENSDART00000144691   None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24096800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22103269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTTTGTTGATTTAAATGCATTGCATTGCTGACTTTTTGTATTTTGCA[G/A]GTTCCTGATCTTTTTTGATGATGGTTATGCCTCATATGTGGGCTTGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 355 1214 8 22
ENSDART00000131249   None 279 None 6
ENSDART00000137317   None 265 None 5
ENSDART00000144691   None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24096436)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22102906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGGGAGGATATTGAGGATGCGTCCTGCAGAGATTTCATTGAGGAGTA[T/A]ATCACATCATATCCTAACAGACCCATGGTTTTACTGAAGCCAGGGCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Essential Splice Site 925 1214 16 22
ENSDART00000131249   None 279 None 6
ENSDART00000137317 Splice Site None 265 None 5
ENSDART00000144691   None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24089091)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22096757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTAAATCCAACAAGATGGAGGAGCGTAACAGCAGCACAACTGGTAAAAG[T/C]GAGAGACCTACGCACACATCTGATTGATGTACTAATGGTTGTGTAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 977 1214 17 22
ENSDART00000131249 Nonsense 168 279 3 6
ENSDART00000137317   None 265 None 5
ENSDART00000144691   None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24088332)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22095998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGTTCGGTGTGGAGGAGCTACACCACTCGCAGACAGGCCAAGGGAT[T/A]GAAGGAAGGTGAGGAGGGAGCATTAAGATGTTTTAATTGAGAGATTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 1083 1214 20 22
ENSDART00000131249 Nonsense 274 279 6 6
ENSDART00000137317   None 265 None 5
ENSDART00000144691   None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24086334)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22093989
KASP Assay ID:
554-7551.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGTGGTGAAAAGGCAGGTGGCTGTGAAGTCCACACGTGGCATTGCTT[T/A]GAAGTCCCACAGTATGATGGTGAAATCAGGTGGAGGGGGTGCAGGAGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088363 Nonsense 1205 1214 22 22
ENSDART00000131249   None 279 None 6
ENSDART00000137317   None 265 None 5
ENSDART00000144691   None 128 None 5

The following transcripts of ENSDARG00000061724 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 24082037)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22088128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATTATGAGGTAGGCAGTGTAGAGGGCAAGGAACTTCTGTGCTGCTGT[G/T]GATCAACAGAATGCAGAGGACGACTGCTGTAACACACACTTGAACACATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link