LOC565752

Ensembl ID:
ENSDARG00000061719
Human Orthologue:
KIAA1033
Human Description:
KIAA1033 [Source:HGNC Symbol;Acc:29174]
Mouse Orthologue:
A230046K03Rik
Mouse Description:
RIKEN cDNA A230046K03 gene Gene [Source:MGI Symbol;Acc:MGI:2441787]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9419 Nonsense Available for shipment Available now
sa19367 Nonsense Mutation detected in F1 DNA During 2016
sa38102 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38101 Nonsense Mutation detected in F1 DNA During 2016
sa44330 Nonsense Mutation detected in F1 DNA During 2016
sa9034 Nonsense Mutation detected in F1 DNA During 2016
sa38100 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088315 Nonsense 420 1173 14 33
ENSDART00000088315 Nonsense 420 1173 14 33
Genomic Location:
Chromosome 25 (position 29611995)
KASP Assay ID:
554-6234.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTACTACATATTTGTAACCTCCTGGATGATGAAGATGGAGTCGATAT[T/A]ATCAAAAGAACCAAAACCAGACAARCTGTCYGAGGATTTGAGCAACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088315 Nonsense 420 1173 14 33
ENSDART00000088315 Nonsense 420 1173 14 33
Genomic Location:
Chromosome 25 (position 29611995)
KASP Assay ID:
554-6234.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTACTACATATTTGTAACCTCCTGGATGATGAAGATGGAGTCGATAT[T/A]ATCAAAAGAACCAAAACCAGACAAGCTGTCCGAGGATTTGAGCAACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088315 Essential Splice Site 596 1173 18 33
Genomic Location:
Chromosome 25 (position 29607185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCTTGTGCTGAAAAAACTAGACTTAATCAGTGAACTAAGAGAACGG[T/G]AAGTTACATTTACTCAGCTAGCAATGCTATAAGCAACAGCAGATTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088315 Nonsense 603 1173 19 33
Genomic Location:
Chromosome 25 (position 29607071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCATGATGGGATATGCTTTCTCCTCAGAGTCAAAGTGCAATGCGACTG[C/A]AGTTTTCTGTACTGGCATCGTACTGTCTTCCCCATCTACCTGGATGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088315 Nonsense 660 1173 20 33
Genomic Location:
Chromosome 25 (position 29606820)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTACATGCCAAACACATGGAGTCATGTGATCAACTGCTGGAGTGTTA[T/A]GACACTGAGATCATGGAAATCCTGAATGAGGTTAACAAAATGAAGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088315 Nonsense 879 1173 25 33
Genomic Location:
Chromosome 25 (position 29600205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAATCCAGAYTCATCAAAGACATCCGATTCTTCAGGGAAACCAAGGAT[C/T]AAACCGACCAAAAGGTAGGTTGGTCTCCATTTGCGTCTTATTATTTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088315 Nonsense 888 1173 26 33
Genomic Location:
Chromosome 25 (position 29600102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTATTCATTTATTTTGACATGCGTGCTGTGTTTAGTACCCATTTGAG[C/T]GAGCAGAAAAGTTCAACCGCGGTATCAGGAAGTTGGGTCTTACTCCAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link