si:ch211-203l9.2

Ensembl ID:
ENSDARG00000061718
ZFIN ID:
ZDB-GENE-060503-775
Description:
Zinc finger protein 704 [Source:UniProtKB/Swiss-Prot;Acc:Q1LY51]
Human Orthologue:
ZNF704
Human Description:
zinc finger protein 704 [Source:HGNC Symbol;Acc:32291]
Mouse Orthologue:
Zfp704
Mouse Description:
zinc finger protein 704 Gene [Source:MGI Symbol;Acc:MGI:2180715]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088358 Nonsense 37 501 1 9
Genomic Location (Zv9):
Chromosome 19 (position 33286568)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32454375
KASP Assay ID:
554-1333.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAACAGGGGACGCGGCTCCGCTCACGGGAGTCATCCAGGCTGTCAAA[C/T]AAGACAACAGGGATGCTTCAACCGGCCATCGGCGCAACGTGTACACCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link