CYTIP

Ensembl ID:
ENSDARG00000061717
Description:
cytohesin 1 interacting protein [Source:HGNC Symbol;Acc:9506]
Human Orthologue:
CYTIP
Human Description:
cytohesin 1 interacting protein [Source:HGNC Symbol;Acc:9506]
Mouse Orthologue:
Cytip
Mouse Description:
cytohesin 1 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2183535]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21428 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9345 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088342 Essential Splice Site 77 358 2 10
Genomic Location:
Chromosome 9 (position 5446023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCCAGAACACACTCAAATTCACTGGTGGATTATACTGATCCTCAGAG[G/A]TAATGATACACTTCGTTATGAATGTCTGATGGTAAACTGAACTGAACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088342 Essential Splice Site 77 358 2 10
Genomic Location:
Chromosome 9 (position 5446024)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGSCAGAACACACTCAAATTCACTGGTGGATTWTACTGATCCTCAGAGG[T/G]AATGATACACTTCGTTATGAAYGTCTGATGGTAAAMTGAACTGAACTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kdvz06vn