si:ch211-203l9.3

Ensembl ID:
ENSDARG00000061713
ZFIN ID:
ZDB-GENE-060503-680
Description:
tumor protein D52 [Source:RefSeq peptide;Acc:NP_001038486]
Human Orthologue:
TPD52
Human Description:
tumor protein D52 [Source:HGNC Symbol;Acc:12005]
Mouse Orthologue:
Tpd52
Mouse Description:
tumor protein D52 Gene [Source:MGI Symbol;Acc:MGI:107749]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36869 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36870 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088340 Essential Splice Site 7 187 1 6
ENSDART00000121829 Essential Splice Site 7 187 1 6
ENSDART00000128465   None 222 None 6
Genomic Location (Zv9):
Chromosome 19 (position 33149939)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32317746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACAACATCAAGAGTCCTCAAAGACAGGATGGAGGAGAACGATAAAGG[T/C]AGTTGAATTCTTCTGCAAATGTGATGTGACATGTCGGCACAGATTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088340 Nonsense 146 187 5 6
ENSDART00000121829 Nonsense 146 187 5 6
ENSDART00000128465 Nonsense 182 222 5 6
Genomic Location (Zv9):
Chromosome 19 (position 33183469)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32351276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGGAACACACCCTCCTTCAAGTCATTTGAGGAGAAAGTGGAAACCT[T/G]AAAGGTAAACCCACAAGCATAATATCAACACTGTGTGTGTGATCTAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link