LOC563727

Ensembl ID:
ENSDARG00000061710
Human Orthologue:
MAP3K8
Human Description:
mitogen-activated protein kinase kinase kinase 8 [Source:HGNC Symbol;Acc:6860]
Mouse Orthologue:
Map3k8
Mouse Description:
mitogen-activated protein kinase kinase kinase 8 Gene [Source:MGI Symbol;Acc:MGI:1346878]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13098 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088319 Nonsense 77 472 2 8
Genomic Location:
Chromosome 12 (position 25080165)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGATGGACGAGAATGAGGAAACGGCACATGACCTAATTAAACATGTA[C/T]AAAAGACTGGAAAGGTCCGTTATGGGACAACATCYGACCTCCTGGACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9ggczr8r