GALNT5

Ensembl ID:
ENSDARG00000061709
Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5) [Sour
Human Orthologue:
GALNT5
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5) [Sour
Mouse Orthologue:
Galnt5
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41345 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088328 Essential Splice Site 471 511 4 5
Genomic Location (Zv9):
Chromosome 9 (position 5283724)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 5306955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGTGCCCTGTCCTGTTATTGATGTTATCAATGATAAAGACATGAGG[T/C]AATCAAATAAAAACCCAGTTATGCAGTTGAAGAAATGTTAAGTTCTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link