si:dkey-149j18.1

Ensembl ID:
ENSDARG00000061699
ZFIN ID:
ZDB-GENE-050420-109
Description:
Novel protein similar to vertebrate signal-induced proliferation-associated 1 like family [Source:Un
Human Orthologue:
SIPA1L3
Human Description:
signal-induced proliferation-associated 1 like 3 [Source:HGNC Symbol;Acc:23801]
Mouse Orthologue:
Sipa1l3
Mouse Description:
signal-induced proliferation-associated 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:1921456]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23346 Essential Splice Site Available for shipment Available now
sa36697 Nonsense Mutation detected in F1 DNA During 2017
sa15094 Nonsense Available for shipment Available now
sa43151 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43150 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Essential Splice Site 455 1718 None 20
ENSDART00000147385 Essential Splice Site 415 1678 None 20
Genomic Location (Zv9):
Chromosome 18 (position 35461174)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37140330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGTTGACCTGGGGGCCAGAAACTACCATGAGCACTTCTATGGGAAAGG[T/A]AAGAAATCTATTGCTTCCATCTAGATAATACATTACACTACGAGATGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Nonsense 632 1718 5 20
ENSDART00000147385 Nonsense 592 1678 5 20
Genomic Location (Zv9):
Chromosome 18 (position 35483600)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37162756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTTTATAGCGGACTCAACTGGAACACACTCCCTGTACACCACCTA[T/A]CAGGACTATGAGATCATGTTTCACGTGTCCACCATGCTTCCATACATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Nonsense 1027 1718 9 20
ENSDART00000147385 Nonsense 987 1678 9 20
Genomic Location (Zv9):
Chromosome 18 (position 35518137)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37197293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGAGCCAGTGGCCGCAGGCTATCGAGCAGKGCAGCGAACCCCAGTAT[G/A]GCGCTGGGACAGTCCTCCTGCTACTCACAGCTCTGCCCAGCGCTGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Essential Splice Site 1487 1718 16 20
ENSDART00000147385 Essential Splice Site 1447 1678 16 20
ENSDART00000088293 Essential Splice Site 1487 1718 16 20
ENSDART00000147385 Essential Splice Site 1447 1678 16 20
Genomic Location (Zv9):
Chromosome 18 (position 35536937)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37216093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTATCGTACTGATTTGTTGTTGTTGTGTGTGTGTGTGCTTGTCTCC[A/T]GTCTCCTCATCGGACACTGCAGCGCACTTTCTCAGATGAGAGTCTGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Essential Splice Site 1487 1718 16 20
ENSDART00000147385 Essential Splice Site 1447 1678 16 20
ENSDART00000088293 Essential Splice Site 1487 1718 16 20
ENSDART00000147385 Essential Splice Site 1447 1678 16 20
Genomic Location (Zv9):
Chromosome 18 (position 35536937)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37216093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTATCGTACTGATTTGTTGTTGTTGTGTGTGTGTGTGCTTGTCTCC[A/T]GTCTCCTCATCGGACACTGCAGCGCACTTTCTCAGATGAGAGTCTGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088293 Nonsense 1588 1718 17 20
ENSDART00000147385 Nonsense 1548 1678 17 20
Genomic Location (Zv9):
Chromosome 18 (position 35537319)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37216475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGCTGGATCCTGGACTCATGCCTCTTCCTGACACTGCCTGTGGTCTC[G/T]AGTGGTCCAGCCTCGTCAATGCAGCCAAAGCTTATGAAGGTACGAGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link