ca14

Ensembl ID:
ENSDARG00000061697
ZFIN ID:
ZDB-GENE-051030-57
Description:
carbonic anhydrase 14 [Source:RefSeq peptide;Acc:NP_001032782]
Human Orthologue:
CA14
Human Description:
carbonic anhydrase XIV [Source:HGNC Symbol;Acc:1372]
Mouse Orthologue:
Car14
Mouse Description:
carbonic anhydrase 14 Gene [Source:MGI Symbol;Acc:MGI:1344341]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9732 Essential Splice Site Available for shipment Available now
sa13345 Nonsense Available for shipment Available now
sa6409 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088276 Essential Splice Site 90 259 4 11
Genomic Location:
Chromosome 16 (position 10880167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAACCCTCCTTACCCTTTATTTGTCCCTTCTGTTTTATTTCTTACACA[G/A]TGCAGATGACATTGCCCCACTGGATGGGTGTAGGGGGGTTGCCATCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088276 Nonsense 105 259 4 11
Genomic Location:
Chromosome 16 (position 10880121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACARTGCAGATGACATTGCCCCACTGGATGGGTGTAGGGGGGTTGCCAT[C/A]ACATTAWAGTGCTGTGCAGCTGYACCTGCACTGGGRTAATGGAGTGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088276 Nonsense 107 259 4 11
Genomic Location:
Chromosome 16 (position 10880114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGACATTGCCCCACTGGATGGGTGTAGGGGGGTTGCCATCACATTA[T/A]AGTGCTGTGCAGCTGCACCTGCACTGGGGTAATGGAGTGGGCATAGCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vqmwxkkq