si:ch211-212d10.3

Ensembl ID:
ENSDARG00000061692
ZFIN ID:
ZDB-GENE-050208-755
Description:
si:ch211-212d10.3 [Source:RefSeq peptide;Acc:NP_001038308]
Human Orthologue:
YJEFN3
Human Description:
YjeF N-terminal domain containing 3 [Source:HGNC Symbol;Acc:24785]
Mouse Orthologue:
Yjefn3
Mouse Description:
YjeF N-terminal domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2681845]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24146 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088270 Nonsense 160 246 5 6
Genomic Location (Zv9):
Chromosome 22 (position 18686349)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18437284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCCATCCTGGGACCCGAAACTGACCACAAGGATGTGAAGGAGCCTTA[T/A]GCTGGGATGCTGGTGACTCTTAAGCAGGTCAAAATACCCATCGTTAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link