si:dkey-149j18.2

Ensembl ID:
ENSDARG00000061691
ZFIN ID:
ZDB-GENE-030131-1441
Description:
glutaminyl-peptide cyclotransferase-like [Source:RefSeq peptide;Acc:NP_001038418]
Human Orthologue:
QPCTL
Human Description:
glutaminyl-peptide cyclotransferase-like [Source:HGNC Symbol;Acc:25952]
Mouse Orthologue:
Qpctl
Mouse Description:
glutaminyl-peptide cyclotransferase-like Gene [Source:MGI Symbol;Acc:MGI:1914619]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43152 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088247 Nonsense 90 392 2 7
Genomic Location (Zv9):
Chromosome 18 (position 35563327)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37242483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATAAGCCAAATAAATACTCTGTGGCACAAGCCAAGAAACTGGCAGGA[C/T]AGGTGGATGGGCATCGGCTTTGGGAGACTCACTTGCGGCCCCTGCTAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Meta-analysis identifies common variants associated with body mass index in east Asians. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link