arvcfb

Ensembl ID:
ENSDARG00000061688
ZFIN ID:
ZDB-GENE-060526-60
Description:
armadillo repeat protein [Source:RefSeq peptide;Acc:NP_001122006]
Human Orthologue:
ARVCF
Human Description:
armadillo repeat gene deleted in velocardiofacial syndrome [Source:HGNC Symbol;Acc:728]
Mouse Orthologue:
Arvcf
Mouse Description:
armadillo repeat gene deleted in velo-cardio-facial syndrome Gene [Source:MGI Symbol;Acc:MGI:109620]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33606 Nonsense Mutation detected in F1 DNA During 2016
sa33605 Nonsense Mutation detected in F1 DNA During 2016
sa13911 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088222 Nonsense 233 918 2 15
ENSDART00000144035   None 124 None 3
ENSDART00000146070 Nonsense 301 986 3 16

The following transcripts of ENSDARG00000061688 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 28031854)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25787152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGGAGGATGACCGCCGCAGTCTTGGGCCTGAAGATGAAGAGCCATA[C/A]GACCTGGAGCCGGATTATTCTACTGCTAACCGGCGCACATTGCCCGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088222 Nonsense 624 918 8 15
ENSDART00000144035   None 124 None 3
ENSDART00000146070 Nonsense 692 986 9 16

The following transcripts of ENSDARG00000061688 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27933835)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25689133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTGTATGTGTGCAGGTTTCGAGTTACTGTATCAGCCGGAGGTGGTT[C/T]GACTCTACCTGTCCCTGCTGACTGAGAGCCAGAACTACAACACGCTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088222 Essential Splice Site 807 918 11 15
ENSDART00000144035   None 124 None 3
ENSDART00000146070 Essential Splice Site 875 986 12 16

The following transcripts of ENSDARG00000061688 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27925777)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25681075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGAGGAACGCCCTVAYCAAGGATGGCTGGAATAAAACACACTTCCAG[G/A]TAGAGTCATAGTRAAAAATCTGGAAAAACTTTAATGTCTGGTGYACNNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link