atxn1a

Ensembl ID:
ENSDARG00000061687
ZFIN ID:
ZDB-GENE-060503-759
Description:
ataxin-1 [Source:RefSeq peptide;Acc:NP_001038291]
Human Orthologue:
ATXN1
Human Description:
ataxin 1 [Source:HGNC Symbol;Acc:10548]
Mouse Orthologue:
Atxn1
Mouse Description:
ataxin 1 Gene [Source:MGI Symbol;Acc:MGI:104783]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088265 Nonsense 211 781 1 2
Genomic Location:
Chromosome 19 (position 33833069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCAAATTGCTGGTTCTCCACTAAGCATATCCCCTCGAACTGTTTCGT[C/A]ACCGCATACACACATGCCCCTACATTTACATCCTCACCACACACTTCCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b5rostbx