hcn4

Ensembl ID:
ENSDARG00000061685
ZFIN ID:
ZDB-GENE-050420-360
Description:
Novel protein similar to vertebrate hyperpolarization activated cyclic nucleotide-gated potassium ch
Human Orthologue:
HCN4
Human Description:
hyperpolarization activated cyclic nucleotide-gated potassium channel 4 [Source:HGNC Symbol;Acc:1688
Mouse Orthologue:
Hcn4
Mouse Description:
hyperpolarization-activated, cyclic nucleotide-gated K+ 4 Gene [Source:MGI Symbol;Acc:MGI:1298209]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11188 Nonsense Available for shipment Available now
sa39186 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093300 Nonsense 315 1124 2 9
ENSDART00000136140 Nonsense 315 1068 2 8
Genomic Location:
Chromosome 18 (position 899580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGCTCGTGGTTCGTGGTGGACTTCATCTCCTCCATTCCCGTGGACTA[T/A]ATCTTCCTCATAGTGGAGACGCGCATYGATTCGGATTTCTACAAGACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093300 Nonsense 586 1124 6 9
ENSDART00000136140 Nonsense 586 1068 6 8
Genomic Location:
Chromosome 18 (position 830039)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTAAACTTCGCTTCGAGGTCTTCCAGCCGGGCGACTACATCATACGA[G/T]AAGGAACCATCGGGAAGAAGATGTACTTCATCCAGCACGGTGTGGTGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link