ENSDARG00000061682

Ensembl ID:
ENSDARG00000061682
Human Orthologue:
BICC1
Human Description:
bicaudal C homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19351]
Mouse Orthologue:
Bicc1
Mouse Description:
bicaudal C homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1933388]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23051 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088242 Nonsense 811 964 21 24
Genomic Location:
Chromosome 17 (position 20820136)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCAAATCTGATAATTGGGGTGATTTGAATGGGAATGTCAATATCAAT[G/T]GAAATGGACCATCAGGAAATTCAGAATTTTCCCAGACTGTCAGCAGCCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nlmcba0t