si:ch73-334d15.1

Ensembl ID:
ENSDARG00000061672
ZFIN ID:
ZDB-GENE-091118-35
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30131 Nonsense Mutation detected in F1 DNA During 2017
sa44178 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088204 Nonsense 88 534 1 1
ENSDART00000135142 Nonsense 88 534 2 2
Genomic Location (Zv9):
Chromosome 24 (position 38220433)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36835099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCACACTACACCTCAATAACGGTGACCCTATCAGAAGCAATAAACATC[G/T]AGAAGCCCGATTTCTTCATCTCGTTCCTCAGCCAAATGATCGAGATACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088204 Nonsense 262 534 1 1
ENSDART00000135142 Nonsense 262 534 2 2
Genomic Location (Zv9):
Chromosome 24 (position 38219910)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36834576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGGACCCGAAATCGATTTCTTCAACTTGCTGCAAGGTGCTGATATTT[G/A]GCTCATTAGGTCGGATTTTATCTTCGAATTTCCCCGTCCGACGATGCCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link