hcn2

Ensembl ID:
ENSDARG00000061665
ZFIN ID:
ZDB-GENE-030131-8228
Description:
Novel protein similar to hyperpolarization activated cyclic nucleotide-gated potassium channel famil
Human Orthologue:
HCN2
Human Description:
hyperpolarization activated cyclic nucleotide-gated potassium channel 2 [Source:HGNC Symbol;Acc:4846
Mouse Orthologue:
Hcn2
Mouse Description:
hyperpolarization-activated, cyclic nucleotide-gated K+ 2 Gene [Source:MGI Symbol;Acc:MGI:1298210]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43812 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43813 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6705 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088193 Essential Splice Site 234 979 2 8
ENSDART00000136390 Essential Splice Site 130 875 2 8
Genomic Location (Zv9):
Chromosome 22 (position 19190275)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18941210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGAACTCAAATATTCAGTAACTAAACTAATGTGCTCATTCTCCTCTT[A/G]GGTTCTACTGGGATTTCACAATGCTAATGTTCATGGTGGGCAACTTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088193 Essential Splice Site 687 979 8 8
ENSDART00000136390 Essential Splice Site 583 875 8 8
Genomic Location (Zv9):
Chromosome 22 (position 19230665)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18981600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGGACACTTAGAAAAAATAAGATATAACTTATCATCTTTTCTTTACA[G/A]GAAAGAAGAACTCCATCCTGATGCACAAAGTACAACATGATCTCAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088193 Nonsense 968 979 8 8
ENSDART00000136390 Nonsense 864 875 8 8
Genomic Location (Zv9):
Chromosome 22 (position 19231508)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18982443
KASP Assay ID:
554-5472.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAGGTCTTCCCAAGAAGGATTCAATAAGCAGCCTCCCAGAAACAGAA[C/T]AACATCACATCAGATCTAGATTATCTTCAAATTTGTGACCTCAATAGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link