igf2bp2b

Ensembl ID:
ENSDARG00000061661
ZFIN ID:
ZDB-GENE-060503-536
Description:
hypothetical protein LOC557028 [Source:RefSeq peptide;Acc:NP_001082843]
Human Orthologue:
IGF2BP2
Human Description:
insulin-like growth factor 2 mRNA binding protein 2 [Source:HGNC Symbol;Acc:28867]
Mouse Orthologue:
Igf2bp2
Mouse Description:
insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890358]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14577 Nonsense Available for shipment Available now
sa12673 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088166 Nonsense 368 446 8 10
ENSDART00000088170 Nonsense 262 340 11 13
ENSDART00000136148 Nonsense 358 436 11 13
ENSDART00000137127 Nonsense 358 436 10 12
ENSDART00000141303 Nonsense 400 478 10 12
ENSDART00000141457 None None 82 None 3
ENSDART00000144916 None None 103 None 3
Genomic Location:
Chromosome 1 (position 29432742)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGTGAAGTTGGAGGCGCATATAAAGGTGCCAWCAASTGCTGCAGGA[C/T]GAGTCATTGGRAAGGGGGGCAAAACGGTAGGTGTGCTTGTTTGTGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088166 Nonsense 368 446 8 10
ENSDART00000088170 Nonsense 262 340 11 13
ENSDART00000136148 Nonsense 358 436 11 13
ENSDART00000137127 Nonsense 358 436 10 12
ENSDART00000141303 Nonsense 400 478 10 12
ENSDART00000141457 None None 82 None 3
ENSDART00000144916 None None 103 None 3
Genomic Location:
Chromosome 1 (position 29432742)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGTGAAGTTGGAGGCGCATATAAAGGTGCCAWCAASTGCTGCAGGA[C/T]GAGTCATTGGRAAGGGGGGCAAAACGGTAGGTGTGCTTGTTTGTGTTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Diabetes (gestational): A genome-wide association study of gestational diabetes mellitus in Korean women. (View Study)
  • Fasting insulin-related traits (interaction with BMI): A genome-wide approach accounting for body mass index identifies genetic variants influencing fasting glycemic traits and insulin resistance. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Type 2 diabetes: A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. (View Study)
  • Type 2 diabetes: Confirmation of multiple risk Loci and genetic impacts by a genome-wide association study of type 2 diabetes in the Japanese population. (View Study)
  • Type 2 diabetes: Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. (View Study)
  • Type 2 diabetes: Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India. (View Study)
  • Type 2 diabetes: Genome-wide association study of type 2 diabetes in a sample from Mexico City and a meta-analysis of a Mexican-American sample from Starr County, Texas. (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: SNPs in KCNQ1 are associated with susceptibility to type 2 diabetes in East Asian and European populations. (View Study)
  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/obkpvt2y