polrmt

Ensembl ID:
ENSDARG00000061658
ZFIN ID:
ZDB-GENE-030131-1528
Description:
DNA-directed RNA polymerase [Source:UniProtKB/TrEMBL;Acc:Q1LXT3]
Human Orthologue:
POLRMT
Human Description:
polymerase (RNA) mitochondrial (DNA directed) [Source:HGNC Symbol;Acc:9200]
Mouse Orthologue:
Polrmt
Mouse Description:
polymerase (RNA) mitochondrial (DNA directed) Gene [Source:MGI Symbol;Acc:MGI:1915843]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24149 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088169 Nonsense 1234 1281 19 21
ENSDART00000145633 Nonsense 1208 1235 18 20
Genomic Location (Zv9):
Chromosome 22 (position 19251257)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19002192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCTTGCATAGTCAGCCTATTCTAGAAGAGCTGTCCTGGTTTCTCCTA[C/T]AGAAATATAGCAGAAGACCTCCGTAAGTCCCTTTGCACTATTCAGTGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link