marveld2b

Ensembl ID:
ENSDARG00000061651
ZFIN ID:
ZDB-GENE-050208-54
Description:
MARVEL domain containing 2b [Source:RefSeq peptide;Acc:NP_001119878]
Human Orthologue:
MARVELD2
Human Description:
MARVEL domain containing 2 [Source:HGNC Symbol;Acc:26401]
Mouse Orthologue:
Marveld2
Mouse Description:
MARVEL (membrane-associating) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2446166]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7564 Missense Mutation detected in F1 DNA During 2014
sa20419 Nonsense Mutation detected in F1 DNA During 2014
sa20420 Nonsense Mutation detected in F1 DNA During 2014
sa25297 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17575 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088175 Missense 188 572 1 6
ENSDART00000137178 Missense 188 572 3 8
Genomic Location:
Chromosome 5 (position 27851178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGACGCTCTTTGCAGACGGCTATGACTTACAGTGAGAAGGTGGARGAG[T/C]ACAATCAGCGCTATGCCTACATGAAGTCCTGGGCYGGACTCTTGCGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088175 Nonsense 202 572 1 6
ENSDART00000137178 Nonsense 202 572 3 8
Genomic Location:
Chromosome 5 (position 27851221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGTACAATCAGCGCTATGCCTACATGAAGTCCTGGGCCGGACTCT[T/A]GCGTATTTTAGGATGCGTGGAGTTGCTTTTGGGTGCTGCTGTTTTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088175 Nonsense 461 572 4 6
ENSDART00000137178 Nonsense 461 572 6 8
Genomic Location:
Chromosome 5 (position 27852509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTAAATGTAAATGTGTTCTGTAATATTTTTCTCCTAACAGGAAATA[T/A]CCAACAATCCGCACTGATGAGGAGAGGGAGCGCTACAAAGCTGTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088175 Essential Splice Site 516 572 4 6
ENSDART00000137178 Essential Splice Site 516 572 6 8
Genomic Location:
Chromosome 5 (position 27852675)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGATAATCTGATGAGGAATCTACCACAACGACCTTCCAGCCAGATG[G/A]TAATGATTTGTAAAACAGTGCATTCTTTCATAATTATCTTACATGCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088175 Nonsense 561 572 6 6
ENSDART00000137178 Nonsense 561 572 8 8
Genomic Location:
Chromosome 5 (position 27855009)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATACCTGAAGAACAAACTTGCTYACATAAAGCAGAAAATTCAGGAGTA[T/G]GACAAAAYCATGGACTGGAATGATGGTTACAGCTAGATGGAACCCYAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ry99yzqr