nrxn1a

Ensembl ID:
ENSDARG00000061647
ZFIN ID:
ZDB-GENE-070206-1
Description:
neurexin 1a [Source:RefSeq peptide;Acc:NP_001073490]
Human Orthologue:
NRXN1
Human Description:
neurexin 1 [Source:HGNC Symbol;Acc:8008]
Mouse Orthologue:
Nrxn1
Mouse Description:
neurexin I Gene [Source:MGI Symbol;Acc:MGI:1096391]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15915 Nonsense Available for shipment Available now
sa35299 Nonsense Mutation detected in F1 DNA During 2017
sa4466 Essential Splice Site F2 line generated During 2017
sa641 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa15915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056256   None 419 None 6
ENSDART00000088159   None 449 None 7
ENSDART00000088178 Nonsense 172 1484 1 23
ENSDART00000093094 Nonsense 172 1491 1 22
ENSDART00000111239 Nonsense 172 1488 1 21
Genomic Location (Zv9):
Chromosome 12 (position 25856160)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 24224836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAACTGCGATCTGTAGCATTACGCCTCACATCTTCAGCCATAAAAGAT[G/T]AGGTTCCCTACAAAGGATGGAYAACCAACCTGAGAGTGAACGGCTCGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056256   None 419 None 6
ENSDART00000088159   None 449 None 7
ENSDART00000088178 Nonsense 425 1484 7 23
ENSDART00000093094 Nonsense 425 1491 7 22
ENSDART00000111239 Nonsense 422 1488 6 21
Genomic Location (Zv9):
Chromosome 12 (position 25956139)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 24328601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGCCGATCTTCCTGGATCACCTGTCAGCAACAACTTTATGGGCTGCT[T/A]GAAAGAGGTAAGAGATTTGAACAATTGCTCCTCGGAAAAAATCAAATCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4466
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056256   None 419 None 6
ENSDART00000088159   None 449 None 7
ENSDART00000088178 Essential Splice Site 771 1484 10 23
ENSDART00000093094 Essential Splice Site 771 1491 10 22
ENSDART00000111239 Essential Splice Site 768 1488 9 21
Genomic Location (Zv9):
Chromosome 12 (position 26015096)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 24387537
KASP Assay ID:
554-3590.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAGGCTGGAGCTGGACGGAGGGCGGGTCCGACTCACTGTCAATCTAG[G/A]TACATCTGCCAATAAGAGCGCTCGTATTGATGGTTNNNACCACCACACAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa641
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056256   None 419 None 6
ENSDART00000088159   None 449 None 7
ENSDART00000088178 Nonsense 1022 1484 15 23
ENSDART00000093094 Nonsense 1022 1491 15 22
ENSDART00000111239 Nonsense 1019 1488 14 21
Genomic Location (Zv9):
Chromosome 12 (position 26044040)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 24416481
KASP Assay ID:
554-0550.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGAATTTTGCTGCCTTTACAGGTGATCTGTATGTTGGAGGTGTGGCT[A/T]AAGATATGTATAAGGACTTGCCAAAGCTGGTGCATTCAAAAGAGGGCTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link