si:ch211-214j8.10

Ensembl ID:
ENSDARG00000061641
ZFIN ID:
ZDB-GENE-060526-101
Description:
ankyrin repeat domain 34B [Source:RefSeq peptide;Acc:NP_001091653]
Human Orthologue:
ANKRD34B
Human Description:
ankyrin repeat domain 34B [Source:HGNC Symbol;Acc:33736]
Mouse Orthologue:
Ankrd34b
Mouse Description:
ankyrin repeat domain 34B Gene [Source:MGI Symbol;Acc:MGI:2443245]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20418 Nonsense Available for shipment Available now
sa33601 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088141 Nonsense 368 548 2 2
Genomic Location (Zv9):
Chromosome 5 (position 27803927)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25559225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGGCATCCATCACAGACACGCTCCCTGTTGAACGGGATCCAGACTG[T/A]CTTCCCAACCTGGCTATTTCAAGTCTGCGTAACGTGTTTCGGCGCCGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088141 Nonsense 430 548 2 2
Genomic Location (Zv9):
Chromosome 5 (position 27804112)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25559410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAACTGGGGGAGTGGAGAAACGCAAGCTTGTTATCAGCCGTTCCT[C/A]AACTCTGTCTGGATCCAGAGAATCTCTGGAGAGTCTGGTCCAGAGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link