myo5aa

Ensembl ID:
ENSDARG00000061635
ZFIN ID:
ZDB-GENE-041027-2
Description:
myosin-Va [Source:RefSeq peptide;Acc:NP_001074428]
Human Orthologue:
MYO5A
Human Description:
myosin VA (heavy chain 12, myoxin) [Source:HGNC Symbol;Acc:7602]
Mouse Orthologue:
Myo5a
Mouse Description:
myosin VA Gene [Source:MGI Symbol;Acc:MGI:105976]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23354 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23355 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088037 None None 1891 None 42
ENSDART00000088038 None None 1843 None 40
ENSDART00000121644 Essential Splice Site 584 1890 16 44
ENSDART00000133618 None None 1844 None 39
Genomic Location:
Chromosome 18 (position 37423242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTCTATGTGTTGTATGTGAACATGACAACCTGTACCCCTGCAGAAGG[T/A]AAAACTCAGCCTATAAATGCACTCTTTAGCGCTATAATCTATCTAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088037 Essential Splice Site 1282 1891 28 42
ENSDART00000088038 Essential Splice Site 1302 1843 29 40
ENSDART00000121644 Essential Splice Site 1281 1890 30 44
ENSDART00000133618 Essential Splice Site 1303 1844 28 39
Genomic Location:
Chromosome 18 (position 37454669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCTGCGCTCACAGCTCGTCAGTCAGAAAGAAGCCATGCAGCACAAG[G/A]TCAGATGCCAAAACTCACATCAGGACTCATATCTGCTCAAATCTGTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nrbey0m7