myo5aa

Ensembl ID:
ENSDARG00000061635
ZFIN ID:
ZDB-GENE-041027-2
Description:
myosin-Va [Source:RefSeq peptide;Acc:NP_001074428]
Human Orthologue:
MYO5A
Human Description:
myosin VA (heavy chain 12, myoxin) [Source:HGNC Symbol;Acc:7602]
Mouse Orthologue:
Myo5a
Mouse Description:
myosin VA Gene [Source:MGI Symbol;Acc:MGI:105976]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23354 Essential Splice Site Available for shipment Available now
sa23355 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36702 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088037   None 1891 None 42
ENSDART00000088038   None 1843 None 40
ENSDART00000121644 Essential Splice Site 584 1890 16 44
ENSDART00000133618   None 1844 None 39
Genomic Location (Zv9):
Chromosome 18 (position 37423242)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39004945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTCTATGTGTTGTATGTGAACATGACAACCTGTACCCCTGCAGAAGG[T/A]AAAACTCAGCCTATAAATGCACTCTTTAGCGCTATAATCTATCTAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088037 Essential Splice Site 1282 1891 28 42
ENSDART00000088038 Essential Splice Site 1302 1843 29 40
ENSDART00000121644 Essential Splice Site 1281 1890 30 44
ENSDART00000133618 Essential Splice Site 1303 1844 28 39
Genomic Location (Zv9):
Chromosome 18 (position 37454669)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39036372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCTGCGCTCACAGCTCGTCAGTCAGAAAGAAGCCATGCAGCACAAG[G/A]TCAGATGCCAAAACTCACATCAGGACTCATATCTGCTCAAATCTGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088037 Nonsense 1607 1891 37 42
ENSDART00000088038 Nonsense 1559 1843 35 40
ENSDART00000121644 Nonsense 1606 1890 39 44
ENSDART00000133618 Nonsense 1560 1844 34 39
Genomic Location (Zv9):
Chromosome 18 (position 37472771)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39054474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCTGGTTGGCCAACACATGTCGTTTTCTGCACTGCCTGAAACAGTA[C/A]AGTGGTGATGAGGTGAGAAATCACACACCATCACAAGAATATGTGAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link