B8JLI4_DANRE

Ensembl ID:
ENSDARG00000061631
Description:
Novel protein similar to H.sapiens FBXO11, F-box protein 11 (FBXO11, zgc:153171) [Source:UniProtKB/T
Human Orthologue:
FBXO11
Human Description:
F-box protein 11 [Source:HGNC Symbol;Acc:13590]
Mouse Orthologue:
Fbxo11
Mouse Description:
F-box protein 11 Gene [Source:MGI Symbol;Acc:MGI:2147134]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22100 Nonsense Mutation detected in F1 DNA During 2014
sa9441 Essential Splice Site Available for shipment Available now
sa18066 Essential Splice Site Available for shipment Available now
sa9342 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22099 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112918 Nonsense 208 929 9 26
Genomic Location:
Chromosome 12 (position 26364758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTGTTTCATAGGAAGAGACTATACATGGAAGTGTTTGAGTACACG[C/T]GACCCATGATGCATCCAGAACCAGGGAAGTTCTACCAGATCAACCCGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112918 Essential Splice Site 347 929 12 26
Genomic Location:
Chromosome 12 (position 26363558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATGGAGGGATCTGAAGATGCATATGTGGGCTACATGACTATCAGGG[T/C]AAGACYAACAGTATTTTTATTTTTTAAGTTATTTACATTTAGCGCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112918 Essential Splice Site 385 929 13 26
Genomic Location:
Chromosome 12 (position 26363295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGCAGCCCCAATATCGACCACTGCGTTATCCGCAGCACCTGCACAGG[T/C]ACCTTTCATTTAGATTAYAGACTTAGTAAAAACATTTGTTKGAAATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112918 Essential Splice Site 781 929 22 26
Genomic Location:
Chromosome 12 (position 26354650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCACCCGGTGCTGCGGAAGAACCGGATATTTGACGGATTTGCTGCAG[G/A]TCAGTTAAAGGTCTAGGTCAGAAGTGCATACATCTTATGTAACAGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112918 Nonsense 858 929 25 26
Genomic Location:
Chromosome 12 (position 26353691)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATTTCACCCTGTTCCATTTTCTCATCTCATCTTAGGTGTCACACCTG[T/A]AACACGACAGACCGGAACGCAATTTGTGTGAATTGTATTAAGAAGTGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/49l0r9yc