LOC556323

Ensembl ID:
ENSDARG00000061611
Human Orthologue:
ENDOD1
Human Description:
endonuclease domain containing 1 [Source:HGNC Symbol;Acc:29129]
Mouse Orthologue:
Endod1
Mouse Description:
endonuclease domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919196]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7594 Missense Mutation detected in F1 DNA During 2014
sa25360 Nonsense Mutation detected in F1 DNA During 2014
sa14708 Essential Splice Site Available for shipment Available now
sa20915 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088043 Missense 80 313 1 2
Genomic Location:
Chromosome 7 (position 23097065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCTAAARAGGATATGCCAGCGCTATGGAGATAAACTACGGTATGCCA[C/A]ACTGTATGACAGCAGCTGCCGGTTGGCACTTTATTCAGCATACACATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088043 Nonsense 102 313 1 2
Genomic Location:
Chromosome 7 (position 23097000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCCGGTTGGCACTTTATTCAGCATACACATTCAAAAAGTCAGATGGA[C/T]AGAGGAGGATGGACACACCCTGGATGTATGAACCACAGGTAGAGTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088043 Essential Splice Site 114 313 1 2
Genomic Location:
Chromosome 7 (position 23096960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGATGGACAGAGGAGGATGGAYACACCCTGGATGTATGAACCACAGG[T/C]AGAGTTTAATTTTCCCAGTTTATCATTTTASAATAAATAATTGTACWGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088043 Nonsense 282 313 2 2
Genomic Location:
Chromosome 7 (position 23096193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAATGAGATAGTGGGACACAGTGTTACAGAAGTGCCTCTGAAGGCTT[T/A]AGAGACCTTTCTGAAAACTAAGTCTAACACGGACAAAAGCGTGAGCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2fupbqfq