si:ch211-51g4.4

Ensembl ID:
ENSDARG00000061603
ZFIN ID:
ZDB-GENE-081028-68
Description:
Novel protein similar to vertebrate sorbin and SH3 domain containing 2 (SORBS2) [Source:UniProtKB/Tr
Human Orthologue:
SORBS2
Human Description:
sorbin and SH3 domain containing 2 [Source:HGNC Symbol;Acc:24098]
Mouse Orthologue:
Sorbs2
Mouse Description:
sorbin and SH3 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1924574]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31989 Essential Splice Site Available for shipment Available now
sa702 Nonsense Available for shipment Available now
sa10480 Nonsense Available for shipment Available now
sa10001 Nonsense Available for shipment Available now
sa15037 Nonsense Available for shipment Available now
sa22499 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088004 Essential Splice Site 20 1586 2 25
ENSDART00000136380 Essential Splice Site 3 253 2 9
ENSDART00000138413   None 115 None 4
ENSDART00000141034 Essential Splice Site 3 141 1 5
ENSDART00000142605 Essential Splice Site 3 1197 3 23
Genomic Location (Zv9):
Chromosome 14 (position 30728446)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29518503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGATATCAAGACACTGCAAGAAGGAGAGATCTTCAATATGAACACAG[G/A]TAAGAGCTAATCCTTTTCTTTTTTGTGGACTGTATGGTTGAAATCTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088004 Nonsense 730 1586 14 25
ENSDART00000136380   None 253 None 9
ENSDART00000138413   None 115 None 4
ENSDART00000141034   None 141 None 5
ENSDART00000142605 Nonsense 725 1197 15 23
Genomic Location (Zv9):
Chromosome 14 (position 30694879)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29484936
KASP Assay ID:
554-0610.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTGTCCGATCTTAGTGACTTCATCCAGATTGAAGGGTCATCTTTTTG[C/A]AGTGAGAGGGAGTTTGACTTGTGTTCATTTGCCTCCTCCGAAAGTTTCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088004 Nonsense 831 1586 14 25
ENSDART00000136380   None 253 None 9
ENSDART00000138413   None 115 None 4
ENSDART00000141034   None 141 None 5
ENSDART00000142605 Nonsense 826 1197 15 23
Genomic Location (Zv9):
Chromosome 14 (position 30694576)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29484633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACCTGTCACCTTTGAGTTTTTCCCRAATGTCAAACTCCAAGAGCTA[T/A]GTGTACGAGACTCTAGATTCAGCTCTAAAAGACATCTATGATCACATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088004 Nonsense 909 1586 14 25
ENSDART00000136380   None 253 None 9
ENSDART00000138413   None 115 None 4
ENSDART00000141034   None 141 None 5
ENSDART00000142605 Nonsense 904 1197 15 23
Genomic Location (Zv9):
Chromosome 14 (position 30694344)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29484401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCTCTTACCACCCACAACCTGATGGCATGTCCAGTCAGGACATTCAC[C/T]AATCCGAGTACTGTCACCTGTCCCATAGTGCCTCTCACAACCATATAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088004 Nonsense 1351 1586 20 25
ENSDART00000136380   None 253 None 9
ENSDART00000138413   None 115 None 4
ENSDART00000141034   None 141 None 5
ENSDART00000142605   None 1197 None 23
Genomic Location (Zv9):
Chromosome 14 (position 30687202)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29477259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTAGAGGATGATCTGTGTGAGGAGCTAGTGTCGATTAYAAAGGCCAGC[C/T]AATCAAAGRGTGCATTCTTAGAAGAGGAGGATTTGTATCACCAAGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088004 Nonsense 1402 1586 20 25
ENSDART00000136380   None 253 None 9
ENSDART00000138413   None 115 None 4
ENSDART00000141034   None 141 None 5
ENSDART00000142605   None 1197 None 23
Genomic Location (Zv9):
Chromosome 14 (position 30687049)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29477106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAGCTTCTTAAATAAAACCCTGCCATCAAATACATTCACTCCACTC[C/T]AACTTGCCCATAGTGAGGGTTCAGATATTGAGGTAGAGCTTGCTGTTTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link