tmem2

Ensembl ID:
ENSDARG00000061600
ZFIN ID:
ZDB-GENE-030131-2179
Description:
Transmembrane protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A3KPQ7]
Human Orthologue:
TMEM2
Human Description:
transmembrane protein 2 [Source:HGNC Symbol;Acc:11869]
Mouse Orthologue:
Tmem2
Mouse Description:
transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2236 Essential Splice Site F2 line generated During 2014
sa13058 Nonsense Available for shipment Available now
sa3523 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2236
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088011 Essential Splice Site 403 1390 4 23
ENSDART00000133217 Essential Splice Site 403 1378 4 22

The following transcripts of ENSDARG00000061600 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 27425006)
KASP Assay ID:
554-3001.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGATGGTGTCGGTTTCACTGTTACTGCTTACAGTGAATGGAGTAATG[G/A]TATGYTTGGACTGCTTCCAATAAAATCCACATTATTGAACAAGAATATRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088011 Nonsense 800 1390 12 23
ENSDART00000133217 Nonsense 800 1378 12 22

The following transcripts of ENSDARG00000061600 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 27444484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAAATAATGMTCTGGGTGCCTGGATTCGTGGAGGTGACATCATCATA[C/T]GAAACTCAGGGTAAGAGAGAGACAAAACTTCTTARTTTATAGTTCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088011 Nonsense 1017 1390 17 23
ENSDART00000133217 Nonsense 1005 1378 16 22

The following transcripts of ENSDARG00000061600 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 27449307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATACAGACKCAGGCCGCATCTAATCTGAGCCTGTCCATCARTAGAGAC[G/T]AATACYCTGATAAACCAATGGTTCTCAGAGGCATCAGAACCAAGACATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yvip59b0