cachd1

Ensembl ID:
ENSDARG00000061590
Human Orthologue:
CACHD1
Human Description:
cache domain containing 1 [Source:HGNC Symbol;Acc:29314]
Mouse Orthologue:
Cachd1
Mouse Description:
cache domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2444177]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17010 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087964 Nonsense 238 1290 6 27
Genomic Location:
Chromosome 6 (position 31331529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTNNNNNNNNTTGTGTTTGCAGGCCTGTGTATGTCGCGGCAGTAAGGCCA[C/T]AATCCAAGCATATCGTGGTGATTATAGACCATGGTGCATCTGTCACCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1a3xbd8f