ctdspl2a

Ensembl ID:
ENSDARG00000061587
ZFIN ID:
ZDB-GENE-061013-647
Description:
CTD small phosphatase-like protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q08BB5]
Human Orthologue:
CTDSPL2
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 [Source:HGN
Mouse Orthologue:
Ctdspl2
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Sourc

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38116 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11079 Essential Splice Site Available for shipment Available now
sa38117 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38118 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Essential Splice Site 109 469 None 13
ENSDART00000132698 Essential Splice Site 119 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33483106)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32093508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGCAGAGCAAACCCCAAAACCCGCAGGAAAGGCCCTGTCAATGGAGG[T/C]AAGAGATGCTGAGCAGGGCCTCAGACTAACATTAATACATTTGGTGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Essential Splice Site 157 469 4 13
ENSDART00000132698   None 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33485522)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32095924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCATCTTCTCTCCTGTTTTTAGCTTCTTCTCGCCCGCCAACAAAAACG[G/A]TAAGCACCYGTGATCTCACTTGTCAGCTGATGAATGTTTTGTATGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Essential Splice Site 158 469 4 13
ENSDART00000132698   None 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33485523)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32095925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATCTTCTCTCCTGTTTTTAGCTTCTTCTCGCCCGCCAACAAAAACGG[T/G]AAGCACCCGTGATCTCACTTGTCAGCTGATGAATGTTTTGTATGTGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Nonsense 261 469 7 13
ENSDART00000132698   None 143 None 4
Genomic Location (Zv9):
Chromosome 25 (position 33488505)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32098907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAATGAAGCCACATATTCACATGCTCACATGTGTCTGTCTTCCAGTTA[T/A]TTCTTTATCAAACACGTGCCACCGCTGACTGAAGAGCAGCTCACCCGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link