ctdspl2a

Ensembl ID:
ENSDARG00000061587
ZFIN ID:
ZDB-GENE-061013-647
Description:
CTD small phosphatase-like protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q08BB5]
Human Orthologue:
CTDSPL2
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 [Source:HGN
Mouse Orthologue:
Ctdspl2
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Sourc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11079 Essential Splice Site Available for shipment Available now
sa5111 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Essential Splice Site 157 469 4 13
ENSDART00000132698 None None 143 None 4
Genomic Location:
Chromosome 25 (position 33485522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCATCTTCTCTCCTGTTTTTAGCTTCTTCTCGCCCGCCAACAAAAACG[G/A]TAAGCACCYGTGATCTCACTTGTCAGCTGATGAATGTTTTGTATGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087978 Nonsense 411 469 11 13
ENSDART00000132698 None None 143 None 4
Genomic Location:
Chromosome 25 (position 33494537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCCTCGGTCGAGATCTTTCCAAGACTGTCATCATCGATAACTCCCCG[C/T]AGGCTTTTGCCTAYCAGGTTTGTGGACAKTCTGCTCTGCTGTTGTGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bugs6tbn