si:ch1073-186e1.1

Ensembl ID:
ENSDARG00000061586
ZFIN ID:
ZDB-GENE-070705-4
Description:
gephyrin2 [Source:RefSeq peptide;Acc:NP_001165871]
Human Orthologue:
GPHN
Human Description:
gephyrin [Source:HGNC Symbol;Acc:15465]
Mouse Orthologue:
Gphn
Mouse Description:
gephyrin Gene [Source:MGI Symbol;Acc:MGI:109602]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43543 Nonsense Mutation detected in F1 DNA During 2017
sa43544 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37171 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087952 Nonsense 34 796 2 25
ENSDART00000130221 Nonsense 13 715 1 21
ENSDART00000133078   None 448 None 14
Genomic Location (Zv9):
Chromosome 20 (position 51230716)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51104444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTTGCAGTCAGTGACAGCTGCTTCCGCAATCTAGCTGAAGAC[C/T]GAAGCGGCGTCAATCTCAAAGATCTCGTCCACGACCCTTCATTGTGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087952 Essential Splice Site 639 796 20 25
ENSDART00000130221 Essential Splice Site 558 715 16 21
ENSDART00000133078 Essential Splice Site 291 448 9 14
Genomic Location (Zv9):
Chromosome 20 (position 51324307)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51176376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCGCTGATGTCATCATCACCTCAGGGGGCGTGTCCATGGGCGAGAAG[G/A]TGAGACCAATTTTATACACTATTCATATTTAGCTTTACATGTATGATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087952 Essential Splice Site 721 796 24 25
ENSDART00000130221 Essential Splice Site 640 715 20 21
ENSDART00000133078 Essential Splice Site 373 448 13 14
Genomic Location (Zv9):
Chromosome 20 (position 51331198)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51183267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGTGAGTATCCATTTACAATCTATTGAAAAATCCCTGTGTTGTTTCC[A/C]GTTGTCCTGTGATGTGAAGCTGGATCCGCGTCCGGAGTATCACCGCTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link