myo1c

Ensembl ID:
ENSDARG00000061579
ZFIN ID:
ZDB-GENE-090429-3
Human Orthologue:
MYO1C
Human Description:
myosin IC [Source:HGNC Symbol;Acc:7597]
Mouse Orthologue:
Myo1c
Mouse Description:
myosin IC Gene [Source:MGI Symbol;Acc:MGI:106612]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16637 Nonsense Available for shipment Available now
sa22660 Nonsense Mutation detected in F1 DNA During 2014
sa7762 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7408 Missense Mutation detected in F1 DNA During 2014
sa12270 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087926 Nonsense 229 1028 5 30
Genomic Location:
Chromosome 15 (position 27678334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGAGGAYGATCTGCTTAGGAGACTAGGYCTGGAGAGAAAYGCCCAA[C/T]AGTACCAGTATCTGGTCAAGGTGAGAGACTGACCTCGCTTGATATGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087926 Nonsense 232 1028 5 30
Genomic Location:
Chromosome 15 (position 27678345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGCTTAGGAGACTAGGCCTGGAGAGAAACGCCCAACAGTACCAGTA[T/A]CTGGTCAAGGTGAGAGACTGACCTCGCTTGATATGATACAGCAGATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087926 Essential Splice Site 370 1028 9 30
Genomic Location:
Chromosome 15 (position 27682196)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACTTTTTCTTGGCTGGTCAACAAAATTAACGACTCTCTGGCCTTCAAG[G/A]TATGGACTCGTTCTGTCRTTAAATACACAGTCRGCACTATGACAGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087926 Missense 719 1028 21 30
Genomic Location:
Chromosome 15 (position 27690050)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCACCCAACTTCAGTCATCCTGGAAGGGCTACAGTCAAAAAACCAAAT[A/G]CCAAAAAATGCGGCACTCGGCTGTCTGGATCCAAGCCTGGTGGAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087926 Nonsense 904 1028 26 30
Genomic Location:
Chromosome 15 (position 27692501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTCCAGTCATTAAGTATGACCGAAAAGGATATAAAGCACGCAACCGA[C/T]AGCTCCTGCTCATGTCTGACAGTGCCGTWATTGTGGAGGAGGGCAAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/doud00qx