colm

Ensembl ID:
ENSDARG00000061576
ZFIN ID:
ZDB-GENE-050119-4
Description:
gliomedin [Source:RefSeq peptide;Acc:NP_001073634]
Human Orthologue:
GLDN
Human Description:
gliomedin [Source:HGNC Symbol;Acc:29514]
Mouse Orthologue:
Gldn
Mouse Description:
gliomedin Gene [Source:MGI Symbol;Acc:MGI:2388361]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2990 Nonsense Mutation detected in F1 DNA During 2014
sa10951 Nonsense Available for shipment Available now
sa18587 Nonsense Available for shipment Available now
sa9035 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087960 Nonsense 86 542 1 9
ENSDART00000087960 Nonsense 86 542 1 9
Genomic Location:
Chromosome 18 (position 38087371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCCGTGGTAGAGTTTATGACGCARGTGAWTGAAGATGAAGCAGAGTA[T/A]CAATACTCAAGRAACAAGCGACGCCGGCAGCACCGAGGGACGCGGCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087960 Nonsense 86 542 1 9
ENSDART00000087960 Nonsense 86 542 1 9
Genomic Location:
Chromosome 18 (position 38087371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCCGTGGTAGAGTTTATGACGCARGTGAWTGAAGATGAAGCAGAGTA[T/A]CAATAMTCAAGRAACAAGCGACGCCGGCAGCACCGAGGGACGCGGCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087960 Nonsense 119 542 1 9
Genomic Location:
Chromosome 18 (position 38087468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTTGAGGAGCAYGAGGGRAGCGTWGGAGAGGAAGTCCTRAGTGATTTC[C/T]AGTACKCGTTTCAGCAGCCGCCTGGACCRGTTTACCAGCACAAAACSRAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087960 Essential Splice Site 168 542 3 9
Genomic Location:
Chromosome 18 (position 38089555)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAYACTTATAAAATCAAGTTTACTGTTTGGTTTATTTTTTGGCTTCCAC[A/T]GGACCACCAGGACCACCAGGAATTGCAGGTAGGAAATCAATTATYCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qf65r8mr