rc3

Ensembl ID:
ENSDARG00000061570
ZFIN ID:
ZDB-GENE-031007-6
Human Orthologue:
DMXL2
Human Description:
Dmx-like 2 [Source:HGNC Symbol;Acc:2938]
Mouse Orthologue:
Dmxl2
Mouse Description:
Dmx-like 2 Gene [Source:MGI Symbol;Acc:MGI:2444630]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17811 Nonsense Available for shipment Available now
sa746 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087935 Nonsense 528 1536 11 17
Genomic Location:
Chromosome 18 (position 39464827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACGGGTGATGCAAAMTCTCTCAGTAAGAACATCATGATGTAYGCCTG[T/A]ACGTTTATGGACCAGGACAGCTGCAGTGCTCTGGAGGAGAAGCGCAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087935 Essential Splice Site 844 1536 15 17
Genomic Location:
Chromosome 18 (position 39471441)
KASP Assay ID:
554-0653.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAAAAGCTTTTCGTTCCCTTTGATATCCATTCCACACATTTTTTTYA[G/A]AACATTATATCTGGGTTGTCTTTGTTGTAGATTACCAGCCACCACCGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kwc3ppjz