LOC100003376

Ensembl ID:
ENSDARG00000061566
Human Orthologue:
SLC7A3
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 [Source:HGNC Symbol;A
Mouse Orthologues:
AU018091, Slc7a3
Mouse Descriptions:
expressed sequence AU018091 Gene [Source:MGI Symbol;Acc:MGI:2142124]
solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene [Source:MGI Symb

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6349 Nonsense Mutation detected in F1 DNA During 2014
sa4564 Nonsense Mutation detected in F1 DNA During 2014
sa22503 Essential Splice Site Available for shipment Available now
sa16407 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087918 Nonsense 171 642 2 11
Genomic Location:
Chromosome 14 (position 31758678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGTGTTGGCAAAATATCCAGATGTGTTTGCCCTGATCCTAGTCATGT[T/A]GCTCACTGGTGAGAACCCTTTTGTTTCTGTTTAAGACCCTGTTTACAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087918 Nonsense 320 642 5 11
Genomic Location:
Chromosome 14 (position 31756208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACKCTCATGATGCCCTATTACATGCTGGACAAGCACAGCCCACTACCT[C/T]AGGCCTTTGATTATGTGGGCTGGGGCCCTGCWCGCTATATTGTGTCCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087918 Essential Splice Site 392 642 6 11
Genomic Location:
Chromosome 14 (position 31754887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACCAAAACTCCTGCCCTGGCAACACTTGTGTCTGGTATTGTAGCAGG[T/G]AAGACTGCACTATTATTAATTTGTTCATGCAATTAATGTCAAGAGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087918 Essential Splice Site 503 642 8 11
Genomic Location:
Chromosome 14 (position 31752938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACCAAGATTTCAGGCATCATTGTTTACTCTGCGTGYGGCACCATATG[T/A]AAGCATTTCATTAAATCAGTCTTTTTCTGAAACCTAGAATTAAAATTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2xen64nf