nlrc3

Ensembl ID:
ENSDARG00000061564
ZFIN ID:
ZDB-GENE-071119-1
Human Orthologue:
NLRC3
Human Description:
NLR family, CARD domain containing 3 [Source:HGNC Symbol;Acc:29889]
Mouse Orthologue:
Nlrc3
Mouse Description:
NLR family, CARD domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444070]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15759 Nonsense Available for shipment Available now
sa13167 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110226 Nonsense 103 1135 2 19
ENSDART00000136703   None 741 None 16
ENSDART00000139021   None 174 None 6
Genomic Location (Zv9):
Chromosome 24 (position 38961137)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37560134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGAGGTCCTGYCGGTCAGYGATCCGCATGGTGCTGCCCTTCAGGCTTA[T/A]CTTCAGAGTTCATACCAGACCGAGTACAACCTTATTACTATAMACGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110226 Nonsense 469 1135 4 19
ENSDART00000136703 Nonsense 75 741 1 16
ENSDART00000139021   None 174 None 6
Genomic Location (Zv9):
Chromosome 24 (position 38963499)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37562395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGAGCGGCATCAGGAAATCATTGAACACTTTGGGTCRTCTTGCTTTTTA[T/A]AGCCTCTTAYGGCGRCGATATACATTYRTCGAGAGCGAATTGCGAACTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link