si:ch73-177h5.1

Ensembl ID:
ENSDARG00000061544
ZFIN ID:
ZDB-GENE-081104-64
Description:
Novel protein similar to vertebrate transmembrane protein 16F (TMEM16F) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
ANO6
Human Description:
anoctamin 6 [Source:HGNC Symbol;Acc:25240]
Mouse Orthologue:
Ano6
Mouse Description:
anoctamin 6 Gene [Source:MGI Symbol;Acc:MGI:2145890]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16196 Nonsense Available for shipment Available now
sa30845 Nonsense Mutation detected in F1 DNA During 2017
sa40199 Nonsense Mutation detected in F1 DNA During 2017
sa33353 Nonsense Mutation detected in F1 DNA During 2017
sa40198 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20176 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087835 Nonsense 401 910 11 20
ENSDART00000139586 Nonsense 356 764 9 16
Genomic Location (Zv9):
Chromosome 4 (position 1753604)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2043659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACTCTGTTCTTGGAGTTCTGGAAACGTTACCARGCCAAACTGGAGTA[C/A]AAGTGGGACACAGTGGAGTTTCAGCAGCAGGAGGAGCAGCCCAGGYCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087835 Nonsense 482 910 13 20
ENSDART00000139586 Nonsense 437 764 11 16
ENSDART00000087835 Nonsense 482 910 13 20
ENSDART00000139586 Nonsense 437 764 11 16
Genomic Location (Zv9):
Chromosome 4 (position 1749891)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2039946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGTGGTCGGGGTGATTGTGTATCGTTTGGCGATGTTTATGGTGTTCT[C/A]GATGCAGCTGCGCTCTGACCTCAATAGAAAAGAGCTGGAGCCGTTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087835 Nonsense 482 910 13 20
ENSDART00000139586 Nonsense 437 764 11 16
ENSDART00000087835 Nonsense 482 910 13 20
ENSDART00000139586 Nonsense 437 764 11 16
Genomic Location (Zv9):
Chromosome 4 (position 1749891)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2039946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGTGGTCGGGGTGATTGTGTATCGTTTGGCGATGTTTATGGTGTTCT[C/A]GATGCAGCTGCGCTCTGACCTCAATAGAAAAGAGCTGGAGCCGTTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087835 Nonsense 672 910 17 20
ENSDART00000139586 Nonsense 627 764 15 16
Genomic Location (Zv9):
Chromosome 4 (position 1746037)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2036092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCTGTGAGTTTCAGGATTATCTGAATGTCTGCTGCGTTCCAGTGATC[C/T]AGTTTGGCTTTGTGACTCTGTTTGTGGCGTCTTTCCCGCTGGCTCCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087835 Essential Splice Site 738 910 17 20
ENSDART00000139586 Essential Splice Site 693 764 15 16
Genomic Location (Zv9):
Chromosome 4 (position 1745835)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2035890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCAGCCCATCCTGCAGGGGGTGACCATTCTGGCGGTGGTCACTAATG[T/C]AAGTCCAGAACATGGATTTCTTCATTTGAATTTGCTGGTGTTGATTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087835 Nonsense 810 910 19 20
ENSDART00000139586   None 764 None 16
Genomic Location (Zv9):
Chromosome 4 (position 1741837)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2031892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCGATCCTGTGAATAAAAATATTCTGTATTCTGTTTTCTTCTCAGGTA[T/A]CGAGATTACAGGAATCCCCCTGATCATCAGAACCCATATCAGTTCAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link