nxt2

Ensembl ID:
ENSDARG00000061527
ZFIN ID:
ZDB-GENE-050521-1
Description:
NTF2-related export protein 2 [Source:RefSeq peptide;Acc:NP_001038913]
Human Orthologues:
NXT1, NXT2
Human Descriptions:
NTF2-like export factor 1 [Source:HGNC Symbol;Acc:15913]
nuclear transport factor 2-like export factor 2 [Source:HGNC Symbol;Acc:18151]
Mouse Orthologues:
Nxt1, Nxt2
Mouse Descriptions:
NTF2-related export protein 1 Gene [Source:MGI Symbol;Acc:MGI:1929619]
nuclear transport factor 2-like export factor 2 Gene [Source:MGI Symbol;Acc:MGI:2147914]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa741 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087842 Essential Splice Site 113 139 6 6
ENSDART00000144076   127 143 5 5
ENSDART00000146344   127 143 4 4

The following transcripts of ENSDARG00000061527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 29479735)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 28153655
KASP Assay ID:
554-0648.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAGAATTTCTTACTAACAGCTCAAGCCTCTCCAAACAGTGACCAGCC[A/T]GTATGGAAAATCGCAAGTGACTGTTTTCGGTTTCAAGACTGGGCAAACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link