b4galnt1a

Ensembl ID:
ENSDARG00000061520
ZFIN ID:
ZDB-GENE-070112-1462
Description:
beta-1,4 N-acetylgalactosaminyltransferase 1 [Source:RefSeq peptide;Acc:NP_001074039]
Human Orthologue:
B4GALNT1
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 1 [Source:HGNC Symbol;Acc:4117]
Mouse Orthologue:
B4galnt1
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 1 Gene [Source:MGI Symbol;Acc:MGI:1342057]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25198 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087815 Essential Splice Site 461 532 11 11
ENSDART00000142514   None 236 None 6
Genomic Location (Zv9):
Chromosome 23 (position 28340807)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28171374
KASP Assay ID:
554-7474.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACTATACATGTGTATATATATAATGTATGTATTTTTATGTCTTCTTC[A/T]GGATTTTTTATTGACGGACTGGGCTCCCTCCACGTGGGCTCCTGTAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link