si:dkey-184d2.1

Ensembl ID:
ENSDARG00000061517
ZFIN ID:
ZDB-GENE-070912-401
Description:
Novel protein similar to vertebrate low density lipoprotein-related protein 1B (Deleted in tumors) (
Human Orthologue:
LRP1B
Human Description:
low density lipoprotein receptor-related protein 1B [Source:HGNC Symbol;Acc:6693]
Mouse Orthologue:
Lrp1b
Mouse Description:
low density lipoprotein-related protein 1B (deleted in tumors) Gene [Source:MGI Symbol;Acc:MGI:21511

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41477 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13908 Nonsense Available for shipment Available now
sa34700 Nonsense Available for shipment Available now
sa9125 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800   None 1186 None 27
ENSDART00000139033 Essential Splice Site 3240 4456 61 87
Genomic Location (Zv9):
Chromosome 9 (position 37670068)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36807964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTGCTTCGAATCCTCCGGAGTTCACTGTTAATCACCGTTTTTTTGC[A/T]GCGGAATTCAAATGCCAGCCTGGGCGATTTCAGTGTGGCACCGGCCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 Nonsense 556 1186 13 27
ENSDART00000139033 Nonsense 3889 4456 75 87
Genomic Location (Zv9):
Chromosome 9 (position 37705924)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36843820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGGACTGACCACTCTAGGATGCACTGGTTCAGTTATTACACAGCTCACT[G/A]GACCAAACTTAGATACTCTATTAATGTGGGGCAGCTCAAGGGACCCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 Nonsense 725 1186 16 27
ENSDART00000139033 Nonsense 4058 4456 78 87
Genomic Location (Zv9):
Chromosome 9 (position 37712060)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36849956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGATTGAAAAAACGACGAATGTCCTGATCTCTCATCGTTTCAAACAG[C/T]AAGATGGTAGGATAATGTTTTCCATTTAGGCTTTTCCTCCTTTTTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087800 Nonsense 941 1186 21 27
ENSDART00000139033 Nonsense 4274 4456 83 87
ENSDART00000087800 Nonsense 941 1186 21 27
ENSDART00000139033 Nonsense 4274 4456 83 87
Genomic Location (Zv9):
Chromosome 9 (position 37728753)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36866649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTTTAGCTCATGCAATTTGTTCTCGTTCTGCCAGCTGTACCAGCGGT[C/T]GAATCGCCTCCAGCTGCCAGTTGTGTGATGGCTACTGCTATAACGGAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link